H-InvDB_8.3 released on March 26, 2013. Search by Keyword H-Inv ID (HIT) H-Inv cluster ID (HIX) H-Inv protein ID (HIP) H-Inv gene family/group (HIF) Accession number Chromosome number Chromosome band Definition* Data source ID --- CCDS ID dbSNP ID (rs number) EC number Ensembl ID EntrezGene ID FR ID FR Accession number GO ID GO name* HGNC gene symbol HGNC gene name* InterPro ID InterPro name* OMIM ID OMIM title* Pathway ID Pathway name* RefSeq (gene) ID RefSeq (protein) ID SCOP ID UniProt for Advanced Search

Home Quick guide Navi BLAST Site map Download Contact us Help

Locus view Protein view G-integra DiseaseInfo Viewer H-ANGEL Evola PPI view Gene Family/Group Hyperlink MS

H-Invitational ID: HIT000437017 Accession number: DQ570486 Created date: 26-Mar-2013 Last modified: 20-Apr-2012 Definition: Non-protein-coding transcript, uncharacterized transcript.

		Select format Flat file XML file Nucleotide sequence fasta

Transcript original information Accession number DQ570486.1 CAGE tag ID NA EST ID NA Clone Number NA Experimental resources   NBRC ; HGPD ; Sequence data provider NA Annotation project NA Length of cDNA 31[bp] (No. of exon:1)[A:7 T:5 G:8 C:11] Devision HUM Molecular type transcribed RNA Library origin Cell type NA Tissue type NA Develpmental stage NA
Sequence quality information CDS feature NA Kozak sequence NA PolyA NA Vector/adapter sequence NA Frame shift NA Remaining intron NA Splice site acceptor (NAGNAG) NA Transcript quality feature NA Notes NA	ACCCGCCGTCGTTCAAGGTCTAGAGCGCCAA

Gene structure information

H-Inv cluster ID		HIX0012738
Genomic location	Chromosome	16
	Location	16p13.3
	Position	2816320- 2816350
	Strand	+
Possible duplicated location(s)		NA
Gene structure		1 exon(s)
Database links	RefSeq	NM_016333;
	Ensembl	ENST00000301740;  ENST00000382300;  ENST00000382301;  ENST00000396975;  ENST00000544933;
	Entrez Gene	NA
	KEGG GENES	NA
	GeneCard	NA *GeneCards is provided free to academic non-profit institutions.
Related H-InvDB links		H-DBAS;  G-integra;  cDNA-genome alignment;

Gene function information

H-Inv ID		HIT000437017
H-Inv cluster ID		HIX0012738
Accession number		DQ570486.1
CAGE tag ID		NA
EST ID		NA
Transcript feature		NO;
Coding potential		Non-protein-coding;
Definition		Non-protein-coding transcript, uncharacterized transcript.
Classification of non-protein-coding transcripts		Classification: Uncharacterized transcript
		Type: NA
		NA
Experimental evidence		NA
PubMed ID		NA
Gene family/group	H-Inv gene family/group ID	NA
	Gene family/group name	NA
	Evidence motif (InterPro) ID	NA
Gene symbol/name	HGNC symbol	NA
	HGNC aliases	NA
	HGNC name	NA
	DDBJ	NA
	UniProt	NA
EC number		NA
GGDB (GlycoGene Database)	Gene symbol	NA
	Familly	NA
	Designation	NA
	Expression	NA
KEGG metabolic pathway		NA
Protein-protein interaction (PPI)	H-Inv protein ID	NA
	No. of interaction	NA
	Interaction partner(s)	NA
	BIND	NA
	DIP	NA
	MINT	NA
	HPRD	NA
	IntAct	NA
Database links	RefSeq	NM_016333;
	Ensembl	ENST00000301740;  ENST00000382300;  ENST00000382301;  ENST00000396975;  ENST00000544933;
	Entrez Gene	NA
	KEGG GENES	NA
	GeneCard	NA *GeneCards is provided free to academic non-profit institutions.
	etc	Human-Gene diversity Of Life-style related Diseases;
Curation status		Auto-annotated
Notes		NA
Related H-InvDB links		Gene family;  Similarity Search Tool;  TACT;

fRNAdb (The functional RNA database) : overlapping fRNAdb entries with H-InvDB transcripts based on the location of the genome.

NA

Disease/pathology information

Last modified:20-Apr-2012

Disease relation		Disease name:NA
Related information in OMIM		OMIM ID:NA Title:NA
Co-localized orphan diseases		OMIM ID:  156850;  605013;  605021;  606668;  607339;  608558;  608903;  610260;
Disease related mutation		NA
Literature-Extracted GENe-Disease Associations (LEGENDA)	Gene name	NA
	Disease	NA
	Substance	NA
Related H-InvDB links		DiseaseInfo Viewer;  LEGENDA;