H-InvDB_8.3 released on March 26, 2013. Search by Keyword H-Inv ID (HIT) H-Inv cluster ID (HIX) H-Inv protein ID (HIP) H-Inv gene family/group (HIF) Accession number Chromosome number Chromosome band Definition* Data source ID --- CCDS ID dbSNP ID (rs number) EC number Ensembl ID EntrezGene ID FR ID FR Accession number GO ID GO name* HGNC gene symbol HGNC gene name* InterPro ID InterPro name* OMIM ID OMIM title* Pathway ID Pathway name* RefSeq (gene) ID RefSeq (protein) ID SCOP ID UniProt for Advanced Search

Home Quick guide Navi BLAST Site map Download Contact us Help

Locus view Protein view G-integra DiseaseInfo Viewer H-ANGEL Evola PPI view Gene Family/Group Hyperlink MS

H-Invitational ID: HIT000383039 Accession number: AM055744 Created date: 26-Mar-2013 Last modified: 20-Apr-2012 Definition: Non-protein-coding transcript, H/ACA box guide small nucleolar RNA (snoRNA) ACA3-2 / MBI-28 / SNORA45

		Select format Flat file XML file Nucleotide sequence fasta

Transcript original information Accession number AM055744.1 CAGE tag ID NA EST ID NA Clone Number NA Experimental resources   NBRC ; HGPD ; Antibody (SNORA45) ; Catalog (SNORA45); Sequence data provider NA Annotation project NA Length of cDNA 131[bp] (No. of exon:1)[A:31 T:31 G:35 C:34] Devision HUM Molecular type transcribed RNA Library origin Cell type NA Tissue type NA Develpmental stage NA
Sequence quality information CDS feature NA Kozak sequence NA PolyA NA Vector/adapter sequence NA Frame shift NA Remaining intron NA Splice site acceptor (NAGNAG) NA Transcript quality feature NA Notes NA	GCCGAGACTAGAGTCACATCCTGACACAACTCTTGTCCTGGTGTGCTAGA GTACTCGAAGAGAATCTACTGGTCTTGATTCACTGGTGGGGGCAGTCGGT GCCCCCGTTAGTGCCCAGATCAGAAACATAC

Gene structure information

H-Inv cluster ID		HIX0079317
Genomic location	Chromosome	11
	Location	11p15.4
	Position	8706986- 8707116
	Strand	+
Possible duplicated location(s)		NA
Gene structure		1 exon(s)
Database links	RefSeq	NR_002977;
	Ensembl	ENST00000391305;
	Entrez Gene	Entrez Gene ID:677826;
	KEGG GENES	KEGG GENES(677826);
	GeneCard	SNORA45;  *GeneCards is provided free to academic non-profit institutions.
Related H-InvDB links		H-DBAS;  G-integra;  cDNA-genome alignment;

Gene function information

H-Inv ID		HIT000383039
H-Inv cluster ID		HIX0079317
Accession number		AM055744.1
CAGE tag ID		NA
EST ID		NA
Transcript feature		Representative transcript;
Coding potential		Non-protein-coding;
Definition		Non-protein-coding transcript, H/ACA box guide small nucleolar RNA (snoRNA) ACA3-2 / MBI-28 / SNORA45
Classification of non-protein-coding transcripts		Classification: Identical to known ncRNA
		Type: short
		Identical to known ncRNA (FR264046) [Identity/coverage = 100.0%/100.0%] to Homo sapiens.
Experimental evidence		NA
PubMed ID		NA
Gene family/group	H-Inv gene family/group ID	NA
	Gene family/group name	NA
	Evidence motif (InterPro) ID	NA
Gene symbol/name	HGNC symbol	SNORA45
	HGNC aliases	NA
	HGNC name	small nucleolar RNA, H/ACA box 45
	DDBJ	NA
	UniProt	NA
EC number		NA
GGDB (GlycoGene Database)	Gene symbol	NA
	Familly	NA
	Designation	NA
	Expression	NA
KEGG metabolic pathway		NA
Protein-protein interaction (PPI)	H-Inv protein ID	NA
	No. of interaction	NA
	Interaction partner(s)	NA
	BIND	NA
	DIP	NA
	MINT	NA
	HPRD	NA
	IntAct	NA
Database links	RefSeq	NR_002977;
	Ensembl	ENST00000391305;
	Entrez Gene	Entrez Gene ID:677826;
	KEGG GENES	KEGG GENES(677826);
	GeneCard	SNORA45;  *GeneCards is provided free to academic non-profit institutions.
	etc	Human-Gene diversity Of Life-style related Diseases;
Curation status		Human curated
Notes		NA
Related H-InvDB links		Gene family;  Similarity Search Tool;  TACT;

fRNAdb (The functional RNA database) : overlapping fRNAdb entries with H-InvDB transcripts based on the location of the genome.

NA

Gene expression information

Last modified:20-Apr-2012

Tissue-specific expression			NA
Probe information	AceGene		NA
	Affymetrix GeneChip	HG-Focus	NA
		HG-U133	NA
		HG-U133A	NA
		HG-U133A_2	NA
		HG-U133B	NA
		HG-U133_Plus_2	NA
		HG-U95	NA
		HG-U95A	NA
		HG-U95B	NA
		HG-U95C	NA
		HG-U95D	NA
		HG-U95E	NA
		HG-U95Av2	NA
		HuEx-1_0	3319607;  3319608;
		HuGeneFL	NA
	Agilent	Human 1A Oligo Microarray:PGID215	NA
		Whole Human Genome Oligo Microarray:PGID247	NA
Related H-InvDB links			H-ANGEL;  DNAProbeLocator;

Disease/pathology information

Last modified:20-Apr-2012

Disease relation		Disease name:NA
Related information in OMIM		OMIM ID:NA Title:NA
Co-localized orphan diseases		OMIM ID:  604499;  607967;  609270;  609470;  611010;
Disease related mutation		NA
Literature-Extracted GENe-Disease Associations (LEGENDA)	Gene name	Entrez Gene ID:(677826)
	Disease	Entrez Gene ID:(677826)
	Substance	Entrez Gene ID:(677826)
Related H-InvDB links		DiseaseInfo Viewer;  LEGENDA;

Polymorphism (SNP, indel), microsatellite (Short Tandem Repeat, STR) and repeat information

Single Nucleotide Polymorphism (SNP) and indel  Location Variation dbSNP ID Strand CDS/UTR Translation 98 .. 98 G/A rs2073686 +  Microsatellite (Short Tandem Repeat, STR) No data available  Microsatellite: Human-Gene diversity Of Life-style related Diseases (H-GOLD) No data available

Repeat  No data available Database links Human-Gene diversity Of Life-style related Diseases(H-GOLD);  Related H-InvDB links VaryGene;  Repeat Mask Viewer;