H-InvDB x AHG DB
Transcript view
H-InvDB_8.3 released on March 26, 2013.
Search by for Advanced Search
Home Quick guide Navi BLAST Site map Download Contact us Help
Locus viewLocus view Protein view Protein view G-integraG-integra DiseaseInfo ViewerDiseaseInfo Viewer H-ANGELH-ANGEL EvolaEvola PPI viewerPPI view Gene Family/GroupGene Family/Group Hyperlink managemnet system (All databases)Hyperlink MS
H-Invitational ID: HIT000039050 Accession number: BC020963 Created date: 26-Mar-2013 Last modified: 20-Apr-2012
Definition: 14-3-3 protein gamma.
 
 

Polymorphism (SNP, indel), microsatellite (Short Tandem Repeat, STR) and repeat information  VaryGene Repeat mask viewer
 Single Nucleotide Polymorphism (SNP) and indel  VaryGene
Location Variation dbSNP ID Strand CDS/UTR Translation
87 .. 87 T/C rs7809278 - 5'UTR
641 .. 641 T/C rs2072435 + CDS Synonymous[Ser150Ser]
656 .. 656 C/T rs111385409 - CDS Synonymous[Ser155Ser]
755 .. 755 C/T rs79130202 + CDS Synonymous[Asn188Asn]
800 .. 800 C/T rs78824969 - CDS Synonymous[Asp203Asp]
917 .. 917 C/T rs73703133 - CDS Synonymous[Gly242Gly]
998 .. 998 G/C rs77248382 - 3'UTR
1077 .. 1077 C/T rs73703132 - 3'UTR
1228 .. 1228 A/G rs80074591 - 3'UTR
1275 .. 1275 T/C rs73357710 - 3'UTR
1432 .. 1432 A/G rs11541900 + 3'UTR
1441 .. 1442 TC/- rs68159547 - 3'UTR
1443 .. 1444 TC/- rs77487318 - 3'UTR
1479 .. 1479 C/G rs11541901 + 3'UTR
1652 .. 1652 C/A rs76063832 - 3'UTR
1684 ^ 1685 -/TTTTGGTTCATAGGTGCTCGG/TTTTGGTTCATAGGTGCTCG rs33915038 - 3'UTR
1694 .. 1694 C/T rs78994924 - 3'UTR
1736 .. 1736 G/T rs117904078 - 3'UTR
1780 .. 1780 A/G rs112558016 - 3'UTR
1975 .. 1975 G/A rs79961113 - 3'UTR
2037 .. 2037 T/G rs111963103 - 3'UTR
2054 .. 2054 A/G rs112392866 - 3'UTR
2208 .. 2208 G/T rs1046304 + 3'UTR
2240 .. 2240 G/A rs76772010 - 3'UTR
2244 .. 2244 T/C rs113115178 - 3'UTR
2253 .. 2253 C/T rs1046305 + 3'UTR
2326 ^ 2327 -/G rs35854099 - 3'UTR
2469 .. 2469 C/T rs75285465 - 3'UTR
2762 .. 2762 C/T rs112298062 - 3'UTR
2789 .. 2789 C/T rs111909239 - 3'UTR
2853 .. 2853 G/- rs71085403 - 3'UTR
3179 .. 3179 G/A rs61680720 - 3'UTR
3267 .. 3267 A/T rs11541903 + 3'UTR
3286 ^ 3287 -/T rs71722031 - 3'UTR
3288 .. 3290 TTT/- rs76457232 - 3'UTR
3296 .. 3296 T/- rs71810596 - 3'UTR
3299 .. 3300 AA/- rs71795765 - 3'UTR
3512 .. 3512 A/G rs115737035 - 3'UTR
3701 ^ 3702 -/A rs34722679 - 3'UTR
 Microsatellite (Short Tandem Repeat, STR)
No data available
 Microsatellite: Human-Gene diversity Of Life-style related Diseases (H-GOLD)
No data available
Mini-G

 Repeat  Repeat mask viewer
No data available
Database links H-GOLDHuman-Gene diversity Of Life-style related Diseases(H-GOLD)
Related H-InvDB links VaryGeneVaryGene Repeat mask viewerRepeat Mask Viewer